Again using primer3, primers amplifying larger products, 400-550 bp, were designed, with the same characteristics as above.
Pairs of specific primers (20 30 bp) were designed with Primer3 [ 21], for binding outside the reading frame, for amplification of the whole OR ORF.
A first panel of 43 amplicons, each of 250 bp was designed, with a total length of 5045 bp (Panel A).
Primers with melting temperatures of 58 60°C, lengths of 20 27 bp, and amplicon lengths of 160 260 bp were designed using Primer3 software (http://frodo.wi.mit.edu/primer3/input.htm).htm
Specially, oligoprimers ORF26LR1F1 (5′-GCAGTATCTATCCAAGTG-3′) and ORF26LR2R2 (5′-ACAGATCGTCAAGCA-3′) producing a 434 bp product were designed with Beacon Designer software (Premier Biosoft) and used for real time PCR (Table 1).
For each input genome, 120-bp baits were designed, with 50-bp overlap (∼2× tiling).
The probes of 50 75 bp in length were designed with similar melting temperatures based on Btau_4.0 genome assembly [ 29].
Using the detailed information on SSR loci obtained from the output of the MISA program, primers for each SSR-containing sequence with a repetitive at least 16 bp in length were designed with Program Primer Premier 5 (PREMIER Biosoft Int., Palo Alto, CA).
Using primer3 [ 65], primers amplifying products of 200-400 bp containing the expected SNP were designed, with primers of 18 22 bp with Tm≈ 55°C, max 5°C difference in Tm and a 2 bp GC clamp.
The following primers and the molecular beacon specific for a 149-bp DNA sequence of human GAPDH were designed with Beacon Designer and purchased from TIB (Molbiol, Berlin, Germany): Sense TGTCTGCTTCTCTGCTGTAG, Anti-sense CTGCCTTCCTCACCTGATG, Probe 5' – FAM – CGCGATCCATGTTCGTCATGGGTGTGAACCAGATCGCG – BHQ1.
Yuan et al.'s microarrays were designed with overlapping 50 bp long probes tiled every 20 bp across the entire Saccharomyces cerevisiae Chromosome 3 and additional regions of interest, such as gene promoters, covering about 4% of the yeast genome.
