Approximately 250 bp and 290 bp were amplified by 5'-RACE and 3'-RACE, respectively.
The OsC1 DNA sequences of 1,311 bp were amplified by use of KOD plus Taq polymerase (TOYOBO, Japan) and Kapa Hifi DNA polymerase with three sets of primers, set 1 (F: 5′-ACATCgTACggggCTACAAg-3′, R: 5′-AgCgTTAgCCAgCTTCAAAT-3′), set 2 (F: 5′-ACTATCTCCggCCTAACATCAA-3′, R: 5′-TAgTAgTCgCAgTCgACgTC-3′), and set 3 (F: 5′-ATgTTgTCAggTggTCTCTC-3′, R: 5′-CACgTT CATgCAACCTTTTg-3′).
The full length 5'LTR of ZAM (473 bp long) called "LTR" and a "ΔLTR" deleted for the first 40 bp were amplified by PCR using forward primers ZAM1: (agttaccgacccatcggtacc) or ZAM40: (taagccaccacgcctacacaa), respectively, and the reverse primer ZAM473CI: (agttacctccggggagtcttg).
Fragments of the Rad promoter region (3050 bp, 1040 bp, 155 bp and 57 bp) were amplified by PCR and subcloned into the pGL3-basic vector to generate the pRad-3050, pRad-1040, pRad-155 and pRad-57 reporter constructs.
S. canicula ScHoxd10 (785 bp) and ScHoxd12 cDNAs (316 bp) were amplified by PCR using the following primers which hybridized to the indicated published sequence: ScHoxd10, GenBank accession number DQ659105, 5'-GGGAACATACGGAATGCAGACC-3' and 5'-GTAAGAGCGTGAATCTGACCG-3'; ScHoxd12, GenBank accession number DQ659106, 5'-CCCTTCTATTTCGCCAACCTG-3' and 5'-CCCAAGTGATACCAGCATCC-3'.
Template DNAs (∼400 bp) were amplified by PCR from CDSs cloned into plasmid vectors.
Using degenerate primers from these peptide sequences, a segment of 70 bp was amplified by PCR from pgafp gene.
The atg31 ORF region and the downstream 600 bp was amplified by PCR and inserted into YEplac181 plasmid after the GAL4 promoter and the N-GST tag sequence.
The optimized coding region for the TcTrx (405 bp) was amplified by PCR and subcloned into an expression vector, pYEX-S1 as described in the Materials and Methods.
The coding region of the ClPDI (1503 bp) was amplified by PCR and subcloned into an expression vector, pET-20b as described in the Materials and Methods.
In short, partial 12S rRNA and partial 16S rRNA fragments (∼100 bp) are amplified by PCR followed by direct sequencing using pyrosequencing technique.
