Sentence examples for bp was performed using from inspiring English sources

Paired-end sequencing (76 bp) was performed using the Genome Analyzer IIx (Illumina Inc).

Paired end sequencing (250 bp) was performed using a MiSeq v2 500 cycle kit (Illumina).

Additional filtering for homopolymers and read size (< 75 bp) was performed using custom written code.

Paired-end sequencing (2 × 75 bp) was performed using TruSeq SBS kits (Illumina).

The final assembly in one large contig of 15,848 bp was performed using SeqMan (DNAStar Inc., Madison, WI, USA).

Paired-end sequencing of 2×50 bp was performed using Illumina's Hiseq2000, pooling 10 samples per lane.

PCRs for GAPDH (278 bp) were performed using the primers AGACAGCCGCATCTTCTTGTGC and CTCCTGGAAGATGGTGATGG. Thirty cycles (95°C for 1 min; 55°C for 1 min; and 72°C for 1.5 min) were performed.

Although the main cellular targets of BPs are the boneresorbing osteoclasts, early work to identify the molecular mechanism of action of BPs was performed using the JJN4 mouse macrophage cell line [ 39].

Amplification of the GNAQ Q209 (298 bp), GNAQ R183 (212 bp), GNA11 Q209 (150 bp), and GNA11 R183 (249 bp) regions was performed using the universal tailed amplicon sequencing strategy as described in the GS Junior System Guidelines for Amplicon Experimental Design (Roche, Mannheim, Germany).

Another PCR assay run to produce an 1157 bp fragment was performed using a primer set designed from the 16S rRNA gene of Candidatus H. suis, and its product was cloned and sequenced.

Single 100 bp sequencing was performed, using standard SBS chemistry (v3) on an Illumina HiSeq2000 sequencer.