Sentence examples for bp sequence corresponding to from inspiring English sources

M9 and M18 deoxyoligonucleotides were used to amplify a 1122 bp sequence corresponding to the BAT1 promoter and M11 and M19 deoxyoligonucleotides were used to amplify a 510 bp region corresponding to the BAT2 promoter.

However, we were not able to identify a single copy of a 13 bp sequence corresponding to the consensus sequence for stoperators of the Cluster A1 type (Fig. 6) and it therefore seems unlikely that LRRHood has acquired gene 44 as a core component to its own immunity system.

We carried out luciferase assays using a 775 bp sequence corresponding to the Shh promoter (Table S1; Mutoh et al., 2010).

In the 3′ deletion variant, the 6 bp sequence corresponding to positions 7 12 of the putative binding site (and positions 11 16 of the miRNA in a putative duplex) was deleted.

A 644 bp Helena sequence amplified from plasmid AF012044 (DsechF: 5' AGGATTTGTCATGCCACGCT 3' e DsechR R 5' TGTTTGGTGCTGCCATGTGT 3'), and a 674 bp sequence, corresponding to the RTase of D. mojavensis Helena (DmojF: 5' TandAGGCCATAGTACGGAGCAGGTA3' anDmojRjR: 5' GCGAATTGGAACAGGCTAACGCAT 3'), were used as probes for the D. simulans and D. mojavensis populations, respectively.

Finally, the 100 bp sequence (corresponding to a simulated error-free Illumina read) was duplicated and each nucleotide of the duplicate read was changed with probability equal to the per-base pair probability of mutation, replacing it with a nucleotide chosen with equal probability among the other three nucleotides.

The experimental tags that matched the human genome or that had no homology to known microbes are removed such that only exact 21 bp sequences corresponding to the microbial virtual tag library are revealed and used for further analysis.

In the whole-site deletion variant, the entire 22 bp sequencing corresponding to the length of miR-503 at its binding site was deleted (QuikChange Lightning Mutagenesis Kit, Agilent).

A phylogenetic tree was generated by comparing the WNV Arizona JW 2004 sequence against 34 other WNV strains by using a 356-bp sequence corresponding to nucleotide positions 260 615 in the cap/prM region.

We calculated pairwise divergences of a 650-bp sequence (corresponding to nucleotide positions 1428 2077 in G. marmoratus mitochondrial genome) from the cox1 5' terminus in the fourteen known orthopteran mitochondrial genomes (See additional file 2: Pairwise divergences of a 650-bp sequence from cox1 5' terminus).

In the case of SpCas9, Cas-OFFinder first compiles all the 23-bp DNA sequences composed of 20-bp sequences corresponding to the sgRNA sequence of interest and the 5′-NRG-3′ PAM sequences (Fig. 1A).