Sentence examples for bp segment corresponding to from inspiring English sources

For the NRPS knockout a 480 bp segment corresponding to positions 1509 to 1990 using specific primers (5'- CCAGAATTCGATGCAAATGCTAGGCT -3' incorporating a EcoRI site and 5'- AGCTAAAGCTTCTAGTTCTGCAACTC -3' incorporating a HindIII site) was used.

If ( R_{2} ) falls into the segment corresponding to ( P_{j} ).

(E – H ), images formed by summing aligned box segments corresponding to the samples in (A – D ).

Each bar is divided into segments corresponding to the numbers (or proportions) of males and females.

It operates through six reportable segments corresponding to its six SBUs.

RET was used to identify trajectory segments corresponding to the hybridized state.

RNA segments corresponding to these neighborhoods were folded using MFOLD, resulting in predicted secondary structures.

MEG data were separated into segments corresponding to the passive, silent periods used in the experiment.

Genomic scaffold segments corresponding to each transcript were extracted along with the flanking 100bp regions.

This resulted in a final set of 3310 genomic segments corresponding to individual putative transcripts.

Segments corresponding to each domain are interspersed along the primary sequence of the enzyme.