Your English writing platform
Free sign upExact(1)
We used engineered nucleases (meganuclease or TALE nuclease) to induce a DSB located at 90 bp of the mutation to be corrected.
Similar(59)
The variant isoforms included one isoform in which intron 7 was retained and two smaller isoforms in which an alternative splice donor either 14 bp upstream or 27 bp downstream of the mutation was used instead.
Four different G to A intragenic suppressor mutations, all within 200 bp of the original dms4-1 mutation, were identified.
Primers, designed to span at least one exon-exon junction, were used to amplify ∼100 bp surrounding the mutation of interest.
The population size of A. pectinata increased significantly since 232 ka BP with the mutation rate of 0.775 % MY−1 (Additional file 7: Figure S3C).
The BSP analysis showed that the population size of C. toreuma had an extremely gentle increase since 260 ka BP (Additional file 7: Figure S3A), and the population size of S. horneri experienced a very slow increase since 194 ka BP with the mutation rate of 1.675 % MY−1 (Additional file 7: Figure S3B).
Bujo et al. (1994) detected a point mutation (G/C) at position 2177 bp of the chicken VLDLR cDNA (mutation named "restricted ovulation" or RO) and showed that the mutant had a reduced egg production [ 16- 18].
Since the control region of mtDNA is likely to evolve neutrally at most sites, we can use Watterson's [ 138] equation to compute N e = S/(L * μ bp * a), where N e is the effective population size of mitochondrial DNA in the presence of background selection, μ bp is the mutation rate per site/generation and a = 1 + 1/2 + 1/3 +... + 1/ n-1) for n sequences in the sample.
A 400 bp DNA fragment surrounding the ScrF1 restriction site (200 bp on each side) located 25 bp downstream of the point mutation was amplified using the upstream primer ACCTGATACTTATTGCTGGCT and the reverse primer GCTAAGAAGGCGATACAATTC.
Plasmids containing atg31 were amplified using primers containing sequences 15 bp upstream and downstream of the mutation site.
To generate primers for a given target SNV, Primer3 software [ 17, 18] was used to produce sequences for up to 50 primer pairs with the following characteristics: 18 to 24 bp primer length, 100 to 160 bp length product size, and a minimum of 4 bp distance between the mutation site and either primer.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.
Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com