"Arthur Clarke once said that when an organism stops pushing its boundaries forward, it starts to die.
The conversations about classicism in burlesque and ballet were identical: How do we both preserve a historic art form while pushing it's boundaries forward?
Once the community of trophic ecologists is aware of the scientific benefit in pushing its boundaries forwards, turning words and good intentions into concrete research projects will depend on the opportunities to obtain research funding.
18th over: England 65-1 (Trescothick 21, Butcher 19) Trescothick's motoring now, scoring the only runs of the Hall over with a boundary driven forward of point, [I'm told].
The residual dislocation lies on the basal-prismatic facet and thus remains glissile should the twin boundary move forward or recede back.
High-resolution structural MRI was obtained in each subject, to define the shells for a boundary element forward solution and to reconstruct the cortex providing the solution space for a noise-normalized minimum norm source estimation procedure.
With BEM, the conductivity within each compartment of the head is assumed to be constant, and surfaces of the compartments (e.g., scalp, outer-skull, and inner-skull surfaces extracted from the 3D volumetric MRI) are tessellated with ~5000 small triangles per surface (boundary elements); forward magnetic fields are calculated using this realistically shaped head model (Mosher et al. 1999).
Primers were designed to amplify across an exon/exon boundary (leptin forward: ACC AAA ACC CTC ATC AAG ACA ATT, leptin reverse: TCC AAA CCG GTG ACT TTC TGT T, leptin probe: ATT TCA CAC ACG CAG TCA GTC TCC TCC A, CD45 forward: CGT AAT GGA AGT GCT GCA ATG T, CD45 reverse: CTG GGA GGC CTA CAC TTG ACA, CD45 probe: ACA ACT AAA AGT GCT CCT CCA AGC CAG GTC T).
An inverse model, useful for interpreting pipeline survey data in terms of the physical condition of pipe coating, was developed by coupling a boundary-element forward model with a nonlinear regression algorithm.
Primers (GeneWorks Pty Ltd., Thebarton, SA, Australia) were designed to cross intron/exon boundaries: RPL13A, forward 5′-ATGGTCGAGGCCATCTCCTG-3′, reverse 5′-TGATGCCTTCACAGCGTACG-3′; ABCG2, forward 5′-CGCATCCTGAGATCCTGAGCC-3′, reverse 5′ TCGACATTACTGGAAGACATCTGG 3′; Bmi-1, forward 5′-TGTCTTTTCCGCCCGCTTCG-3′, reverse 5′-TCTCGT TGTTCGATGCATTTCTGC-3′.
