Your English writing platform
Discover LudwigSuggestions(1)
Exact(1)
The classification is made over the segments extracted with the ground truth boundaries to evaluate the classification accuracy over the whole segment.
Similar(59)
A novel ultrasound method was developed which analyses the reflections at the transducer-fruit boundary to evaluate the quality of the fruit as a whole.
Specifically, we generated an equal number of random locations (potential nest sites) to used locations (actual nest sites) within each study area boundary to evaluate non-random turkey nest site selection.
PCR primers were designed and used to amplify the exon 2/3 boundary to evaluate splicing (splchkf: 5'- GTGTGGCCATTAGTATCCAG; splchkr: 5'- GCTGTAGGTTGATCCTCTTG).
Firstly, we designed a splice junction morpholino targeted against the first coding exon-intron boundary to evaluate the knockdown effect and efficacy in vivo.
The frame consists of three parts: the classical Gouy-Chapman model coupled with interface charging mechanisms to describe EDL in oil-brine-rock systems, three methods with different boundary assumptions to evaluate EDL interaction energy, and the modified Young-Dupré equation to link EDL interaction energy with contact angle.
A moving boundary was configured to evaluate the time-dependent cake growth behavior.
A modified version of the previous model, using the water table as the impermeable lower boundary, is used to evaluate the permeability of the low-permeability stiff clay layer (3.2 × 10− 10 cm2) and permeable sand (7.2 × 10− 7 cm2) beneath it.
This approach is general and can be employed in conjunction with any numerical techniques such as finite element or boundary element methods to evaluate the QFM SIFs at the nanoscale for many fracture problems in engineering practice.
The aims are to investigate the sensitivity of the structures and dynamics of low swirl flames to the inflow boundary conditions and to evaluate the capability of an LES flamelet model in predicting the stabilization and local extinction of the flames.
Different boundary conditions were investigated to evaluate free open boundary conditions in applying CFD to predict heat release rate (HRR) and the air flow through the opening.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com