Sentence examples for bound is placed on from inspiring English sources

Exact(2)

If the unresolved transient decay is negligible, as is usually the case, no lower bound is placed on the frequency range of the impedance spectrum.

Moreover, in a different scenario, CUEs have been prioritized and an upper bound is placed on the maximum transmission rate of all links.

Similar(56)

To predict gap-filling reactions, a small lower bound was placed on the known producing or consuming reaction for each knowledge gap metabolite, and SMILEY was run.

The protein of E. coli is placed on the silicon chip which binds to the similar protein in the presence of contamination.

More broadly, pressure is bound to be placed on Israel to lift the blockade of Gaza as part of a wider ceasefire deal, one of the proposals set out by coincidence in a report on the Middle East published by the international development select committee.

This situation occurs when the number of events is small and/or the seasonality is strong enough so that no upper bound can be placed on the strength of seasonality (the fitted trough of the sine curve is close to zero).

A hard bound of 10 was placed on the number of forward regression steps.

The selected clone expressing 3F peptide that bound to TFLO11/F2 was placed on N-terminus of the full-length peptide and PCR amplified with primer 1 (GAGTTGCGTCT GACGCCGCCATGGCGGAGAGGCCCTACGCATGC) and primer 2 (GCCGCATCTTT TTGGTCCGTCCCCGCCCGTGTGTATCTTGGTATG).

The clone expressing the 3F peptide that bound to TFLO11/F1 was placed on C-terminus of the full-length peptide and PCR amplified with primer 3 (TCAAGTTGCAGATCTGAGAGGCCCTACGCATGCCC TGTC) and primer 4 (CATTTAGGAATTCCGGGCCGCGTCCTTCTGTCTCAGATGGA TTTT) and Pfu polymerase, at the annealing temperature of 64°C.

A lower bound of −0.01 was placed on the cob(I alamin exchange reaction.

No lower bound can yet be placed on the local scale on which the global signature is reflected.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: