Sentence examples for bottom template from inspiring English sources

As the thickness of evaporated metal goes thinner, the discontinuity of the metal film un-avoidably appears due to large lattice mismatch between the template and metallic material as well as the surface non-uniformity of the bottom template.

The F1 target sequence was inserted at two different positions with respect to the promoter: +28 (top template) and +181 (bottom template).

Use the bottom template to mark with a pen how wide the inside should be.

To make the nanowires better dispersion in the aqueous solution, the copper is first deposited to fill the dendrite structure at the bottom of template.

It was observed that the GaN nanostructures was grown inside the nanopores of SiO2, bridging the top NELO GaN and the bottom GaN template.

Although the bi-polarized atomic bonding of the bottom GaAs template or inhomogeneous surface atomic deformation could also play a role here, we have used a smooth Ga-rich surface as the epitaxial template to minimize these two issues.

After chemical removal of the SiO2 nano-networks, the GaN with nanostrutures releases spontaneously from the bottom GaN template layer, leading to a high quality GaN film with a nanostructured surface on one side.

The inner hexagon is the diffraction spots of the bottom GaAs template, and the outer one is for epi-aluminum film, indicating that the epitaxial relationship of Al with GaAs is (100 GaAs // (111 Al, <011 > GaAs // (

The region upstream to the miR-375 gene (putative miR-375 promoter region) was generated by PCR using primers 5' - GAAGATCTTGAGGTACATCGCAGAGGCCAG - 3' (top) and 5' - CATGCCATGGGGGCCGGAGCGGAAGACCC - 3' (bottom) with template of genomic DNA.

For the bottom layer (template library), we used the sequence motifs from PROSITE [ 30] version-20.68 and Pfam [ 31] version-24.

It retained the shape and vertical directions of the bottom undoped nanorod template.