Sentence examples for both strands were obtained from inspiring English sources
Sequences from both strands were obtained for each specimen, aligned in BIOEDIT v. 7.0.5.2.
Primer sequences for amplification and initial sequencing are: 5' tttgccagggtccagttg, and 5' cttggatatacaaagtggtacgt. Full sequences of both strands were obtained using internal sequencing primers.
Sequence chromatograms from both strands were obtained on automated sequence analyzer ABI3730XL (Applied Biosystems).
The nucleotide sequences from both strands were obtained with an ABI 3130xl sequencer (Applied Biosystems, California, USA).
Sequence chromatograms from both strands were obtained on an automated sequence analyser ABI3730XL (Applied Biosystems) with the PCR primers.
The second strands were obtained with a 5'-primer (GGAATACTAGTGACACCAGACAAGTTG dA15).
For Region A, between 100 and 600 reads of individual bisulphite-treated strands were obtained for each sample.
cDNA first strands were obtained from total RNAs using 1 μg total RNAs and SuperScript™ II reverse transcriptase (Invitrogen, Carlsbad, San Diego, CA, USA).
Sequences from the complementary strands were obtained for all taxa whenever possible, using the BigDye Terminator v3.1 on a 3730 DNA Analyzer (Applied Biosystems/Hitachi).
The hair segment was identified based on the date the hair strands were obtained (cut from the nape of the neck) and the individual's hair growth rate value.
The oligonucleotides (both top and bottom strand) were obtained from Integrated DNA Technologies, INC.
