Sentence examples for both fragments were sequenced from inspiring English sources

Both fragments were sequenced and the presence of the 57 bp intron in the larger 272 bp fragment was confirmed.

The PCR fragments were sequenced in both strands in an ABI 3730 sequencer using a BigDye v3.1 sequencing kit (Applied Biosystems, Foster City, CA), and were compared with the revised Cambridge reference sequence, CRS [16] (Table 2).

All fragments were sequenced in both directions on an ABI3730 automated sequencer (Applied Biosystems).

Both strands of all DNA fragments were sequenced.

Primers used for amplification were the following (sequences listed in 5' to 3' orientation): GAPDH: ACCACAGTCCATGCCATCAC and TCCACCACCCTGTTGCTGTA; CD28: CTCACACTTCGGGTTCCTCG and GGTCATTTCCTATCCAGAGC. RT-PCR fragments were sequenced both forward and reverse (MWG).

Both strands of the PCR fragments were sequenced.

Both ends of the inserted fragments were sequenced.

Both strands of the PCR fragments were sequenced using the above-mentioned primers.

Both strands of the PCR fragments were sequenced with the above-mentioned primers.

In the case of non-specific amplifications, PCR products were cloned using the pGEM®-T Easy Vector System (Promega), according to manufacturer's instructions, and both strands of the cloned fragments were sequenced using the M13F and M13R universal primers.

The amplified DNA fragments were sequenced with an ABI-3730 sequencer.