Sentence examples for both ends use the from inspiring English sources

After tying a knot in both ends, use the bound soap scrap bag as an exfoliating body scrubber.

Cleaned fragments were sequenced from both ends using the di-deoxy chain terminator method [34], with V3.1 Bigdye terminator chemistry [35].

Purified PCR products were first directly sequenced from both ends using the forward and reverse primer.

Inserts were sequenced from both ends using the standard Sanger method.

The resulting amplicons were sequenced from both ends using the same set of primers that were used for PCR.

The full-length sequences were finished by trimming the vector-derived sequences from both ends using the cross_match program.

The PCR products were purified (QIAquick PCR Purification Kit, Qiagen, CA) and sequenced from both ends using the PCR primers.

BAC clones were sequenced from both ends using the primers T7 (5'-TAATACGACTCACTATAGGG-3') and SP6 (5'-ATTTAGGTGACACTATAG-3').

The arterial segment was then cannulated at both ends using the customized pipette and manipulating system shown schematically in Figure 1.

For the shotgun phase [ 47], pUC plasmids with inserts of mostly 1.4 2 kb were sequenced from both ends using the dideoxy big dye terminator chemistry [ 48].

cDNAs were sequenced from both ends using the pDNRlib-specific vector primers pDNRfw: AGTCAGTGAGCGAGGAAGC or pDNRrev: CCAAACGAATGGTCTAGAAAG on an Applied Biosystems 3730xl DNA Analyzer.