Sentence examples for both constructs were confirmed from inspiring English sources

Both constructs were confirmed using DNA sequencing.

Full length ACOX2, and ACOX2-i9 were cloned into the TOPO-pcDNA3.1-V5/His vector (Sigma) using the following primers; ACOX2 forward 5'CACCATGGGCAGCCCAGTGCA 3', ACOX2-i9 forward 5' CACCATGAGTAGATGCTCAGTA 3', reverse (same for both) 5' TAGCTTGGATCTCCAACTTTG 3' and both constructs were confirmed by sequencing.

Following subcloning, the identity of both constructs was confirmed using multiple restriction digestion analyses.

The DNA sequence of both constructs was confirmed by DNA sequencing, and the plasmids were transformed into Rosetta 2 DE3) (Novagen).

Both the constructs were confirmed by nucleotide sequencing.

After both of the constructs were confirmed by sequencing, the plasmids expressing N-terminal His6-tagged BlaC WT and mutant proteins were transformed into Escherichia coli BL21/DE3 cells and cultured in LB broth at 37 °C.

Expression of both TLR2WT and TLR2ΔTIR constructs were confirmed after transfection by western blot using anti-GFP antibody (data not shown).

Both strands of all DNA constructs were confirmed by sequencing.

All these constructs were confirmed by both restriction enzyme digestion and DNA sequencing.

The constructs were confirmed by both restriction digestions and PCR.

All constructs were confirmed by sequencing on both strands.