Your English writing platform
Discover LudwigSuggestions(1)
Exact(1)
Samples highlighted in bold were flagged for downstream analysis.
Similar(58)
They were flagged for costly personal fouls.
Patients were flagged for mortality.
The vehicle is flagged for secondary inspection.
Bold is used for best values.
But remember bold isn't for everyday.
Data were reviewed and flagged for invalid values.
Primers YX771 (TCGACGACTACAAGGACGACGATGACAAGGGCGGAGCCGATTATAAGGATGATGACGACAAGGC, bolded are 2 FLAG repeats separated by a linker of Gly-Gly-Ala) and YX772 (GGCCGCCTTGTCGTCATCATCCTTATAATCGGCTCCGCCCTTGTCATCGTCGTCCTTGTAGTCG, bolded are 2 FLAG repeats separated by a linker of Gly-Gly-Ala) were annealed and subcloned into Sal1/Not1-cut 314CUPha-FLAG vector (7) to obtain 314CUPha-3FLAG.
BOLD-clusters were assessed for anatomically correct sensorimotor localization.
BOLD-clusters were assessed individually for anatomical localization.
Be bold, Roy, be bold.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com