Sentence examples for bold sites from inspiring English sources

Bold: sites at which influenza was detected.

Bold: sites where influenza was detected.

Lung function data were obtained at all BOLD sites using the ndd EasyOne Spirometer (ndd Medical Technologies, Andover, MA, USA).

Additional sequence was added to encode a His-tag, EcoRI (underlined) and XbaI (bold) sites and an additional tail to enhance cloning.

The human H1 RNA promoter was PCR-amplified from p Silencer™ 3.1-H1 hygro (Ambion) with the following primers: 5′-GTGAATTCATATTTGCATGTCGCTATGTG-3′ and 5′-AAAAAGCTT CCAAAAAATTGGTT CCATGGGAATGGAGATCTGTGGTCCATACAGA-3′, to introduce one BglII and two BstXI (bold) sites.

Restriction sites BamH1 and EcoRI in primers An--F/R and the mutated site are underlined; Start and stop codons are marked in bold; site-directed mutagenesis site is underline in I249L-F and I249L-R.

This general linear model comprised site-specific electrophysiological variables, which means we tested for a uniform relationship between electrophysiology and BOLD over sites (i.e. a linear relationship that was estimated with a single regression coefficient or parameter of our multiple linear regression model).

These homology arms were subcloned (using the bold restriction sites) into the pLHED vector (Kokubu et al., 2009).

Left to right columns: 1) positions in 1AMU_A, bold are sites corresponding to the 10 or 13 AA code.

Bold indicates sites predicted to be under stronger selection in Physalis than in Solanum by both ωp/ωs and FEL CSP tests.

A second set of oligonucleotides was used to amplify ERα sequence: (S.2 GATCTGATATCGGTACCAGTCaccatgaccctccacaccaaagc (ATACGCATACGGATCCTCAGACTGTGGCAGGGAAACCCTCCTC (part in bold: BamH1 sites, part in small: overlapping parts).