Your English writing platform
Discover LudwigExact(10)
The outcome eventually hinged on a bold sequence of line-outs taken in preference to goal kicks.
Full complementary DNA: AAATACAACGGCATAATAACTGAAA. Single nucleotide DNA: AAATACAACGTCATAATAACTGAAA. Noncomplementary DNA: TGAAGCTAACCGGTAAGCGCTATAG. The bold sequence is the stem sequence of the MB.
Underlined, bold sequence: nucleotides specific for alternative splice site.
The cyclin D1 promoter region was PCR amplified using the olg88 (5'-ATTG GGTACCTAAATCCCGGGGGACCCA Cthe', the bold sequence is a KpnI restriction site) and olg89 (5'-CCGG AAGCTTGGAGGCTC CAGGACtheGCA-3', the bold sequence is a HindIII restriction site).
After the acquisition of a BOLD sequence of a patient at rest with their eyes open, postprocessing determines which regions present a temporal correlation in BOLD-signal fluctuations.
Wu Zhiyuan et al. used the BOLD sequence to observe the changes in the brain when performing acupuncture at the right ST36 of 12 healthy volunteers.
Similar(49)
Long before comics existed, artists used bold sequences of images to tell stories.
c) Integration site sequences retrieved from TAIL-PCR analysis of transformants #2, #8, #10, #11 and #12; The underlined and highlighted in bold sequences represent the portion of the T-DNA adjacent to the unknown sequence obtained by PCR.
This resulted to the dual-luciferase reporter containing wildtype rno-miR-335 binding seed sequences (bold sequences).
Bold sequences indicate the PD-ODN2006 sequence.
Bold sequences refer to primer tags that contain a restriction site (named in following column).
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com