Sentence examples for bold forward from inspiring English sources

"I want sudden, bold, forward, determined war," he thundered from the Senate floor.

Add 1 to 2 tablespoons fish sauce, aiming for a bold, forward finish that's a little gutsy.

Through his inability to think beyond his own ego, he had led his men into an impossible situation, and in the scathing rebel musket fire that followed, Baker discovered, all too briefly, the real meaning of "bold, forward, determined war".

But Brooks argued that, as with practically every other bold, forward thinking question, there are several sides to consider.

This type of bold, forward thinking -- along with real results that show the benefits of integration -- is the only antidote to the reactionary social movements arising across Europe today.

To generate pInv-H1-sip53, the pInv-H1-siDC-SIGN was digested with EcoRI and BglII and ligated with the annealed, phosphorylated oligonucleotides corresponding to the sip53 sequence (in bold): forward: AATTCACTCAAAAACGACTCCAGTGGTAATCTACGTT TTTCAGTA; reverse: GATCTACTGAAAAACGTAGATTACCACTGGAGTCGTTTTTGAGTG.

"Charlotte Bronte was a bold, forward-thinking lady for her time.

It's a pretty bold, forward-thinking move for Allen to go with Amazon Prime for distribution, especially given he was accused of being out of touch with some of his recent films, the dialogue in which some critics found anachronistic.

The surprisingly backward state of Seattle transport tells a story familiar to many American cities: an aesthetically bold, forward-looking optimism in the years after the second world war, followed by decades of bitter struggle with its own demanding suburbs, home in this case to the mighty or once-mighty likes of Boeing and Microsoft.

It was my favorite not because the advice was good (though it was - the trains entering the station generate a gale-force updraft), but because it was hand-painted in those bold, forward-leaning capital letters so beloved of sign painters 30 or 40 years ago.

Accordingly, I propose a bold, forward-looking solution.