Sentence examples similar to bold and underlining from inspiring English sources

Similar(60)

* SignalP3 algorithm [ 2] ** using the PredGPI algorithm [ 25] Bold and underlined: proteins are detected by mass spectronomy in the secretome enriched fractions N.A.: Not available, classifier predictions are not valid, because the cluster-size is too small Carbon source starvation conditions were chosen to induce extracellular proteases.

Don't forget to bold and underline your title, and remember to pass it in on time!

Use bolding and underlining to emphasize the most important points, but do so sparingly.

In Microsoft Word, you need to navigate to the Font tab to find the group of options that includes italicizing, bolding, and underlining.

Utilize bolding, italics and underlining.

While Manziel has recently spoken about his desire to return to pro football, we're working with a question of "if" and not "when", and the "if" is bolded and underlined.

Favourable alleles are bolded and underlined; description of the markers is presented in Table  2.

The cDNA fragments cloned encoded for the following peptide fragments of the IL-10E1 gene, including: Amino acids bolded and underlined were mutated.

Many of these could not be assigned because they were within 10 Å of the heme iron with its five unpaired electrons (bolded and underlined in the list above); however, it was possible to assign several of the residues with backbone N values of <10 Å [L57 (9.49 Å), Y105 (9.75 Å), L123 (7.75 Å), and Y134 (9.59 Å)].

The sequences of primers used for generating Flag-Sox2-HMG expression plasmid are listed below: Flag-Sox2-HMG-U: GAACAGCCCGGACCGCGTCAAG Flag-Sox2-HMG-L: GCGGCTTCCGGTCCGTCTCCATC Bold, italicized, and underlined sequences in Flag-Sox2-HMG-L primer refers to bases changed to introduce an RsrII restriction site.

Additional file 1 reports the complete RHNumtS compilation: there, NumtS exclusively identified by Blastn are shown in grey and NumtS exclusively identified by Blastn, but only on Human Genome Celera Assembly, shown in black in columns "Nuc start" and "Nuc end"; repeated NumtS in bold type and underlined in columns "Mt start" and "Mt end".

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: