Sentence examples for blot analyses were done from inspiring English sources

Western blot analyses were done with various specific primary antibodies.

Line scans and blot analyses were done with ImageJ software.

Western blot analyses were done as previously described.

Western blot analyses were done by chemiluminescence using the Immobilon Western Chemiluminescent HRP Substrate (EMD Millipore).

Western blot analyses were done using B0AT1 and SN2 specific antibodies.

After treatments, western blot analyses were done using standard methods (Casado-Zapico et al, 2010).

RNA-extract preparations and northern-blot analyses were done as described previously [2].

Gene-specific PCR amplification used the following primers: TEC1_RACE (GAAAGTAATCCTGAGTT CAGTTCCA); TEC1_3UTR_R (GTTCGAGAACTGGTAATGTTTGACT); PHD1_RACE (AAGTTGTTGAATGTCACGAAGATG); and PHD1_3UTR_R (ATTG TACGAATCCTATCAGCCTTTC). Protein-extract preparations and western-blot analyses were done as described previously [2], except that extracts included Phosphatase Inhibitor Cocktails 1 and 2 (Sigma).

Lipid rafts were distributed in fractions 1 to 3 of the gradient whereas non-lipid rafts corresponded to fractions 7 to 9. Western blotting analyses were done using pooled lipid raft and non-lipid raft fractions.

Indirect immunofluorescence (IF) and western blot (WB) analyses were done essentially as previously described [61].

Western blotting and immunoprecipitation analyses were done as described [26] using the anti-active-β-catenin [42] mouse monoclonal antibody (Upstate, Lake Placid, USA, # 05-665) and the anti-LRP5 goat polyclonal antibody (Santa Cruz Biotechnology INC., # sc-21390).