Sentence examples for blend of forward from inspiring English sources

Exact(1)

The price tag is also about 16 times more than a blend of forward and historic earnings.

Similar(59)

Our state should be a symbol of diversity, creativity, transformation, and a unique blend of tradition and forward thinking -- where everyone has the opportunity to participate freely and without prejudice.

5 µl of template were amplified in 50 µl reactions in 96-well plates with 1.25 U Expand High Fidelity Taq/Tgo polymerase blend (Roche), 15 pmol of forward primer (tgtaaaacgacggccagt), 15 pmol of reverse primer (agcggataacaatttcacacagga) and 200 µM of each dNTP (TaKaRa) in 1× Expand High Fidelity buffer (Roche).

Historically driven by interests in simulating weather and climate processes, the numerics of EULAG are unique, owing to a synergistic blend of non-oscillatory forward-in-time MPDATA methods, robust elliptic solver, and generalized coordinate formulation enabling grid adaptivity.

After 2012 there is a great blend of youth to go forward". The environment created cannot have been ideal for the pair's team-mates, particularly younger players trying to break through the ranks.

In a program that sounds typical of the company's blend of technology and human movement, Forward Motion will present works by Eric Dunlap featuring video and costumes threaded with fiber-optic light.

The silent members are only there to learn, take notes, observe, and ultimately carry the legacy of the blend forward for the next 50 years (hey, no pressure).

With his signature blend of comedy and absurdism, Armisen adds a sense of forward motion and propulsion to this dreamy pop cover.  .

Playing and composing, Moncur achieved a remarkable blend of forethought and spontaneity; this forward-looking work is very much within the tradition.

The 10% alcohol ale uses an "intergalactic blend of hops" including such fruit-forward varietals as Galaxy, Equinox, Citra and Mosaic.

In 2011, the Sixth Congress of the Communist Party outlined its own tropical perestroika in the Lineamientos, a forward-looking blend of goals, strategies, and values intended to adapt the island's socialist project to the contemporary global order.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: