Sentence examples for biopsy samples were used from inspiring English sources

In addition, endometrial biopsy samples were used for immunodetection of markers for angiogenesis (Vascular Endothelial Growth Factor A, its receptor 2, as well as angiopoietin-2 and its receptor-tyrosine-kinase Tie2) during the estrous cycle (three mares, d 0, 5 and 10; one biopsy per mare).

For genotyping, mouse-tail biopsy samples were used to extract genomic DNA, from which a 376 bp PCR product was generated by using the primer pair FACmRho6020 (5'TCCGGandTGTATGCTCACCAC3') and Rho3 (5'TGAGGGAGGGGTACAGATCC3').

Second, needle biopsy samples were used.

Core or fine-needle aspiration (FNA) biopsy samples were used for the correlative studies.

Fully anonymized biopsy samples were used in accordance with each institution's ethical rules.

The other routinely obtained biopsy samples were used for microbiological culture and Rapid Urease Test (RUT), as described below.

The rounded average expression of the three core biopsy samples was used for each patient.

The remaining part of the biopsy samples was used to determine the intrahepatic peretinoin concentration.

For MIB1 index, the 5% value (median value in the radiotherapy biopsy samples) was used to group cases as of high or low proliferation index.

This 3D μFCA system may provide better predictions of drug responses and identification of a suitable treatment for a specific patient if biopsy samples are used.

Fibroblasts cultured from a proband skin biopsy sample were used for molecular characterization of the endogenous GR mutation in vivo.