Sentence examples for biopsy sample were used from inspiring English sources

Fibroblasts cultured from a proband skin biopsy sample were used for molecular characterization of the endogenous GR mutation in vivo.

DNA from the biopsy sample was used for a molecular analysis in order to identify the infectious agent.

A homogenized biopsy sample was used to infect Vero cells, where a cytopathic effect typical of orthopoxviruses was seen after 2 days.

In addition, endometrial biopsy samples were used for immunodetection of markers for angiogenesis (Vascular Endothelial Growth Factor A, its receptor 2, as well as angiopoietin-2 and its receptor-tyrosine-kinase Tie2) during the estrous cycle (three mares, d 0, 5 and 10; one biopsy per mare).

For genotyping, mouse-tail biopsy samples were used to extract genomic DNA, from which a 376 bp PCR product was generated by using the primer pair FACmRho6020 (5'TCCGGandTGTATGCTCACCAC3') and Rho3 (5'TGAGGGAGGGGTACAGATCC3').

Second, needle biopsy samples were used.

Core or fine-needle aspiration (FNA) biopsy samples were used for the correlative studies.

Fully anonymized biopsy samples were used in accordance with each institution's ethical rules.

Paraffin-embedded biopsy samples were used for immunohistochemistry. Biopsy and tissue samples were also used to make protein extract for western blotting.

The other routinely obtained biopsy samples were used for microbiological culture and Rapid Urease Test (RUT), as described below.

Cartilage explant cultures were prepared using 3 mm punch biopsy specimens, thus ensuring that only full-depth cartilage biopsy samples were used.