Sentence examples for biochemical sequences from inspiring English sources

Short biochemical sequences may want to replicate themselves ad infinitum, their neighboring sequences be damned; yet genes get together under the aegis of cells and reproduce in orderly fashion as genomes, as collectives of sequences, setting aside some of their immediate selfish urges for the sake of long-term genomic survival.

Development of MRI systems with ultra-high field strength, multi-channel coils, and more signal-to-noise ratio-efficient sequences may allow the implementation of biochemical sequences in clinically feasible scan times to allow early detection of cartilage lesions before they become morphologically apparent.

The biochemical sequence that leads from phenylalanine accumulation to intellectual disability remains obscure, although it is likely that the underlying pathophysiology evokes alterations of brain energy metabolism, neurotransmitter synthesis, and myelin formation (myelin is the insulating material found around the axons of neurons).

Furthermore, the cellular and biochemical sequence of events in these repaired or reconstructed menisci is unknown, and both descriptive and experimental studies will be required to understand the mechanical and the biological role of these techniques in limiting or delaying knee degeneration.

Biochemical sequencing analysis was conducted on small molecular weight eluates derived from HPLC fractionation of human DS lens protein extract (Fig. 4).

Making sense of DNA data is a two-step process, namely the biochemical-sequencing of the DNA and the analyzing and extracting insights from the sequenced DNA data.

For MALDI analysis, protein-containing gel slices were S-alkylated (slices were incubated sequentially with 10 mM/50 mM NH4HCO3 ml DTT (Sigma) for 30 minutes at 55°C and 25 mM/50 mM NH4HCO3 ml iodoacetamide (Sigma) for 30 minutes at RT, digested with trypsin (Roche Molecular Biochemicals, sequencing grade) and extracted according to Shevchenko et al. [8].

This activity has been variously described as a 5'-3' exonuclease, a 5' nuclease [7] and most commonly as a flap endonuclease or FEN activity [8] due to the biochemical and sequence homologies with their eukaryotic counterparts.

PCR products were purified using ExoSAP-IT (United States Biochemical) and sequenced directly using an ABI 3730 (Applied Biosystems) at the Indiana Molecular Biology Institute.

Oligonucleotide probes (LLS1, CACCA CTATCATCATCATCAAT and LLS2, TCATCACCATCACCAGCACC) were labelled with ?P-ATP by enzymatic phosphorylation with polynucleotide kinase (Roche Molecular Biochemicals; the sequences corresponding to the probes LLS1 and LLS2 are double-underlined in Fig. 2).

This cannot be right: N-acetylation is a cytosolic modification, based on the biochemical and sequence data characterizing the protease plasmepsin V, its active site is almost certainly on the cytoplasmic face of the membrane, and the only possible location for PI3P at the ER membrane is in the cytosolic leaflet.