Sentence examples for binds to intronic sequences from inspiring English sources

Exact(1)

Pair 2 (CCTCATTTGCTGTCCTGGTT, CCCTGGTGTCCTGTCATCTT, product 208 bp) binds to intronic sequences around the insertion site of the stop and detection cassette and differentiates between hom and wt/het genotypes.

Similar(59)

Interestingly, this mechanism has been also proposed for several hnRNP proteins bound to intronic sequences [77] [79].

ExSpeU1s bind by complementarity to intronic sequences downstream of the exon and rescue different types of splicing defects associated to exon skipping.

Moreover, we observed enhanced sequence conservation in minimal introns as compared to intronic sequences from large introns and intergenic sequences (Figure 1C).

PTBP2 is reported to control the assembly of other splicing regulatory proteins and binds to intronic polypyrimidine tracts during splicing.

The active sequences are designed to be complementary to intronic sequences of the primary transcript of the target genes.

Fig. 3B demonstrates that the consensus motif for SF2/ASF is highly enriched at the edges of exons relative to intronic sequences or the interior of exon sequences.

Primers were designed to intronic sequences (sequences available on request).

Primers were designed from Ensembl (www.ensembl.org) to correspond to intronic sequences for each target gene.

As to intronic sequences, in comparison with POLYAR, both polya_svm and polyadq show higher sensitivity.

Although intronic splicing enhancers are best known for their association with the spliceosome [ 40, 41], it is also known that SR proteins can bind to intronic splicing elements [ 42].

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: