In order to ensure that the presence of the MITE did not interfere with the overall efficiency of the binding, we designed an additional 426 bp probe [using as alternative reverse primer RG5196-FISH-r2 (5'ACCATGCCCTGCTCTAGAAA3')] that included partial sequences of exons 2 and 3, as well as a full sequence of intron 2, but not the third intron.
To understand the contributions of each ASM in 7SK-SL1apical for Tat binding, we designed constructs to individually disrupt the formation of each of the ASMs (ASM1U76A, ASM2U72A, ASM3U40A, and ASM4ΔU63).
Starting from the available information about the binding of the purine-based htIIα inhibitors in the ATP binding site we designed a virtual screening campaign combining structure-based and ligand-based pharmacophores with a molecular docking calculation searching for compounds that would contain a monocycle mimetic of the purine moiety.
To define the roles of individual bases of the direct-repeat motifs in binding PhoP, we designed a series of DNA sequences with mutations in the motifs and analyzed their binding affinity for PhoP by ITC (Table 1).
To characterize the interactions between Gab2 and its SH2-containing binding partners, we designed a modified yeast two-hybrid system in which the Lyn tyrosine kinase is expressed in a regulated manner in yeast.
To identify a binding site, we designed a series of oligonucleotides covering the entire region between bcg1280c and the first 10 nucleotides of raaS (Fig. 3B) and performed electrophoretic mobility shift assays (Fig. 4B).
To confirm the role of the repeat motifs in binding specificity, we designed a series of duplex DNA sequences based on the dominant sequence identified from SELEX experiments and assayed their binding affinity for PhoP by an EMSA.
To investigate the effects of l- or d-Pro kink incorporation into hydrophobic or hydrophilic helix face of KLW on structure, cell selectivity, and membrane-binding affinity, we designed a series of four peptides, in which Leu9 and Lys11 in the hydrophobic and hydrophilic helix face of KLW, respectively, are substituted with l- or d-Pro.
To determine the significance of cation binding to DNA stability, we designed a modification that stably placed a cation at a position in the major groove similar to that of diffusible cations observed in the crystal structures.
