Sentence examples for binding was removed from from inspiring English sources

Exact(1)

As shown in Fig. 4A, at each time interval in the course of the incubation, HIV-1 p24 binding was removed from the cells by EDTA to an equal extent at 37°C and 4°C.

Similar(59)

deletion construct: a 64 bp GC-rich fragment located at positions -722 to -658 of the S100a6 promoter (5'CTAGCCTCAGGCGCCGGGTGGGGCTCGGGGCGGGCCGGCACTCCTTGGGCGGGCCTCCCGGATG-3'), containing two putative SP1 binding sites, was removed from construct dS16 by NheI digestion.

For saturation binding, the media was removed from each well, then 100 µl serum-free media (DMEM/F12 containing 2 nM L-glutamine) or 100 µl propranolol 20 µM added to each well.

For competition binding, the media was removed from each well, 100 µl of serum-free media containing the competing ligand at twice the final required concentration was added to each well followed immediately by a 100 µl of a fixed concentration of 3H-CGP12177 (1∶2 dilution in well, final well concentrations of 1.24 nM to 12.10 nM).

Prior to performing the binding assay, free steroid hormone was removed from vaginal tissue extracts by incubating samples with dextran coated charcoal (DCC).

After completion of binding at 4°C, free ligand was removed from the dishes by four washes with ice-cold assay medium (2 ml per wash).

To evaluate the accuracy and reliability of the docking procedure, co-crystallized native ligand rilpivirine was removed from its binding site of 3MEE and again subjected to dock into the same binding pocket (Fig. 3).

The ligand VPL57 was removed from the binding site and re-docked.

The G180 fusion protein was removed from the nucleus, demonstrating that the binding of chromosomes is linked to the EAST portion of the fusion protein (not shown).

Thereby a putative binding site for the ZF-HD proteins FtHB1 to FtHB4 [ 14] was removed from the C4-PR.

The reformist president was removed from power for attempting to hold a non-binding referendum on the constitution, a move his enemies said was proof that Zelaya wanted to stand for a second consecutive term.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: