The groups responsible for citrate binding were identified as Thr-58, Arg-66, His-69, Ser-101, Leu-102, Lys-109, Ser124, and Arg-107.
All sulfhydryl sulfur atoms located in the optimal position for zinc-binding were identified as positive for activity.
The binding medium was identified as an alkyd by the C=O stretching vibration at 1726 cm−1, the C O stretches at 1263, and 1118 cm−1, the aromatic C=C in-plane deformation at 1068 cm−1, and the weak aromatic C=C stretching vibrations at 1599 and 1579 cm−1 which proposed an ortho-phthalate alkyd [9 13].
Furthermore, Lys608 within this binding region was identified as the acetylation site.
At the time of its identification, no RNA binding protein was identified as a partner of the HP1 protein family.
Using de novo motif discovery and known motifs over-representation on the ARRB1-associated sequences identified in parental and nucARRB1 cells, the HIF1A::ARNT binding motif was identified as the most significant (Fig 5C).
Collectively, the M1-binding site was identified as the stabilizing metal-binding site, which needs to be intact, and perhaps constantly occupied by Co2+, to maintain the functionality of TmCorA.
This CS6-binding compound was identified as sulfatide (SO3-3Galβ1Cer), whish is the major acid glycosphingolipid of the human small intestinal epithelial cells [13].
The 20-bp sequence ACAAGGGCCCCTTTGTGCCC (from −162 to −143), which contained no known transcriptional factor-binding sites, was identified as a novel cis-acting element and was designated SSE.
