A further role for the juxta-membrane region of β-dystroglycan is in binding to the neuromuscular junction (NMJ) protein rapsyn [ 70].
In addition, serum autoantibodies binding to the dermal epidermal junction by immunofluorescence microscopy also mainly belong to the IgG4 and IgG1 subclasses [ 10, 11, 61, 83].
The mismatched control LCN7 morpholino (5'GTAAACGCACTGCGAGGGTTGGGAA) was identical to the specific LCN7 morpholino except for the presence of 5 mismatched bases (underlined) that disrupt efficient binding to the LCN7 exon1 – intron1 splice junction.
Following cortactin binding to the nascent branch junction, we added a cortactin-mediated displacement activation step (kdis) analogous to the GST-VCA-dependent activation step (knuc).
A possible explanation for the results is that besides binding to the double-stranded region at the junction, XPA may additionally bind only to one ssDNA sequence without preference for either a 3′- or a 5′-ssDNA overhang.
The end-plate potentials (EPPs) that are the depolarizations of skeletal muscle fibres caused by neurotransmitters binding to the postsynaptic membrane in the neuromuscular junction are facilitated initially, followed by a depression.
ZONAB (zonula occludens 1 (ZO-1 -associated ZO-1 -associatednding protein)/DbpA (DNA-binding protein A) is a Y-box transcription factor that is recruited to tight junctions by binding to the Src homology 3 domain of ZO-1 -associatedtter, 2000).
According to our proposed secondary structure model (Figure 1B), MgZ adopts a three-way junction structure when binding to the substrate.
Structural modelling with these data suggests a clamp-like DBD for the XPA binding to ds/ssDNA junctions.
