Sentence examples for binding sites were deleted from inspiring English sources

c-Jun-mediated activation was not observed when the binding sites were deleted in the Bim-luc reporter (−1.2 kb).

Simulations were also carried out for in silico mutant strains wherein the Mig1p binding sites were deleted from the MEL1 and GAL1 genes.

In the first PCR reaction, 2 sets of primers CCND1-UTR-5.3 and CCND1-UTR-3.6 ACAAAAAACTGATCCTCCAAGCTGCGGCCTGTCCCCGGTGT; CCND1-UTR-5.6 ACACCGGGGACAGGCCGCAGCTTGGAGGATCAGTTTTTTGT (complementary to CCND1-UTR-3.6) and CCND1-UTR-Not1-3.4 CCND1-UTR-Not1-3.4 CCND1-UTR-Not1-3.4 CCND1-UTR-Not1-3.4 the miR-503 binding sites were deleted.

When one of the two potential RUNX1 binding sites was deleted, basal luminescence intensity and induced luciferase activity after RUNX1 and/or CBF β transfection were abolished.

In fact, several genes in the DAL gene cluster are induced by the orc2-1 mutandon, atd at least two of these genes are also induced by deletion of nearby ORC binding sites, and not by the orc2-1 mutation when these binding sites are deleted from orc2-1 cells [ 5].

First, seven nucleotides of the nine-nucleotide sequence in the BP1 binding site were deleted to generate delLB170, followed by insertion of the mutated sequence, described in [ 23], to create mutLB170.

The results show that when all the three AP-1-binding sites were deleted, BMP-6 lost its inhibitory effect on miPPR-21; so did the induction of miPPR-21 activity by TPA (Figure 4B).

The ATFs were identified by screening a combinatorial library of zinc finger-containing transcription factors for components that activated the transcription of a reporter gene under the control of a truncated GAL1 promoter from which the GAL4p-binding sites were deleted.

Next, the wild-type (WT) constructs containing let-7a binding CCR7 3'UTR and mutant type (MUT) constructs were prepared, in which the binding site was deleted.

The same procedure was used to clone Luc-VEGF-A-UTR and Luc-VEGF-A-UTR-d where the putative miR-205 binding site was deleted.

In the whole-site deletion variant, the entire 22 bp sequencing corresponding to the length of miR-503 at its binding site was deleted (QuikChange Lightning Mutagenesis Kit, Agilent).