Sentence examples for binding sites were amplified from inspiring English sources

PPARγ/RXR ChIP-PET binding sites were amplified from 3T3-L1 genomic DNA by PCR and cloned into the pGL4-TATA vector (a minimal TATA box upstream of pGL4- Basic) by homologous recombination using the In-Fusion CF Dry-Down PCR Cloning kit (Clontech, http://www.clontech.com).

rpoS were constructed as follows: The rhlR and rpoS ORFs including native ribosomal binding sites were amplified from PAO1 genomic DNA by PCR.

Fragments of the 3′UTR of RTEF-1 containing putative or mutated miR-125a-5p miR-125a-5p miR-125a-5pified bindingCR usitesspecific primers (Table S2).

The human miR-181c/d promoter sequences containing the Egr-1 binding sites were amplified by PCR using the following primers: (forward) 5′-ACAGGTCAAAAGCGACGGGG-3′ and (reverse) 5′-TCACGGTGGTGGCAACGGAA-3′.

A fragment of 488 bp of N gene of PPRV containing the real time RT-PCR primers binding sites were amplified using the primer pair N3F (forward primer): 5′-CAAAGC GCCGA CGGCA TCA GGTT-3′ (48 70) and N3R (reverse primer): 5-���GCCAGAAGGATCCAGACTTGTGC-3′ (514–536) (In house designed).

The human TRAIL promoter region containing the Sp1 binding sites was precipitated using either the anti-Sp1 antibody or IgG, and using the probe 1 (forward) and the probe 5 (reverse) shown in Figure 5A as gene-specific primers and the sequence (136 bp) encompassing the Sp1 binding sites was amplified.

A 4-kb fragment of the 4.8-kb human TFGBR1 3'UTR (containing both putative let-7c binding sites) was amplified by PCR applied on genomic DNA extracted from HEK293 cells, using primers: 5'- CCAAGTTTAAACAGATCTGCTCCTGGGTTTTA (PmeI), and 5'- CCAAGCTAGC-ACCGGTATGCTCTGACAAATATTAAAC (NheI, AgeI), and cloned into the PmeI/NheI sites of pmirGLO, to generate pmirGLO-TGFBR1-long 3'UTR.

However, due to the simultaneous binding of the primer on both DNA strands, the sequence between the two binding sites is amplified.

A region of the human FOXO1 3'-UTR containing three miR-1269 binding sites was amplified by PCR and cloned into vector pGL3 (Promega, Madison, WI, USA).

The fragment containing three RUNX3 putative binding sites was amplified using the forward primer, 5′-GGGCAGAGCAGAGCTACAAATG-3′, and the reverse primer, 5′-AACCCAGCTCTAGCCAGCAGGT-3′.

The sequence located between the F3 and B3 primer binding sites was amplified using primers OP1 (5′-CACCGCCAGCGTTCCCTAT-3′) and OP2 (5′-AACTGCTGAAATGGCTGGAC-3′).