To further confirm that miR-205-mediated reduction of the luciferase activity for Luc-ErbB3-3'UTR vector is due to direct interaction between miR-205 and its putative binding site, we deleted the miR-205 binding site by side-directed mutagenesis, resulting in Luc-ErbB3-3'UTR-d.
To further explore the myosin-binding site, we deleted the UCS signature motif 602 630 that composes an elongated, highly conserved loop next to the UCS channel.
To delete miR-503 binding sites, we used a two step PCR procedure.
To introduce four base pair deletion of the seed region of the miR-29a binding site, we used a PCR approach where the seeds sequences were deleted in the primers used for PCR reactions (Table S1).
To delete the putative miR-205 binding site, we adopted two-step PCR methods as described previously (54).
When one of the two potential RUNX1 binding sites was deleted, basal luminescence intensity and induced luciferase activity after RUNX1 and/or CBF β transfection were abolished.
Simulations were also carried out for in silico mutant strains wherein the Mig1p binding sites were deleted from the MEL1 and GAL1 genes.
In fact, several genes in the DAL gene cluster are induced by the orc2-1 mutandon, atd at least two of these genes are also induced by deletion of nearby ORC binding sites, and not by the orc2-1 mutation when these binding sites are deleted from orc2-1 cells [ 5].
In the first PCR reaction, 2 sets of primers CCND1-UTR-5.3 and CCND1-UTR-3.6 ACAAAAAACTGATCCTCCAAGCTGCGGCCTGTCCCCGGTGT; CCND1-UTR-5.6 ACACCGGGGACAGGCCGCAGCTTGGAGGATCAGTTTTTTGT (complementary to CCND1-UTR-3.6) and CCND1-UTR-Not1-3.4 CCND1-UTR-Not1-3.4 CCND1-UTR-Not1-3.4 CCND1-UTR-Not1-3.4 the miR-503 binding sites were deleted.
