Sentence examples for binding sites we deleted from inspiring English sources

Exact(1)

To determine the importance of two miR-503 binding sites, we deleted these two sites.

Similar(58)

To further confirm that miR-205-mediated reduction of the luciferase activity for Luc-ErbB3-3'UTR vector is due to direct interaction between miR-205 and its putative binding site, we deleted the miR-205 binding site by side-directed mutagenesis, resulting in Luc-ErbB3-3'UTR-d.

To further explore the myosin-binding site, we deleted the UCS signature motif 602 630 that composes an elongated, highly conserved loop next to the UCS channel.

To delete miR-503 binding sites, we used a two step PCR procedure.

To introduce four base pair deletion of the seed region of the miR-29a binding site, we used a PCR approach where the seeds sequences were deleted in the primers used for PCR reactions (Table S1).

To delete the putative miR-205 binding site, we adopted two-step PCR methods as described previously (54).

c-Jun-mediated activation was not observed when the binding sites were deleted in the Bim-luc reporter (−1.2 kb).

When one of the two potential RUNX1 binding sites was deleted, basal luminescence intensity and induced luciferase activity after RUNX1 and/or CBF β transfection were abolished.

Simulations were also carried out for in silico mutant strains wherein the Mig1p binding sites were deleted from the MEL1 and GAL1 genes.

In fact, several genes in the DAL gene cluster are induced by the orc2-1 mutandon, atd at least two of these genes are also induced by deletion of nearby ORC binding sites, and not by the orc2-1 mutation when these binding sites are deleted from orc2-1 cells [ 5].

In the first PCR reaction, 2 sets of primers CCND1-UTR-5.3 and CCND1-UTR-3.6 ACAAAAAACTGATCCTCCAAGCTGCGGCCTGTCCCCGGTGT; CCND1-UTR-5.6 ACACCGGGGACAGGCCGCAGCTTGGAGGATCAGTTTTTTGT (complementary to CCND1-UTR-3.6) and CCND1-UTR-Not1-3.4 CCND1-UTR-Not1-3.4 CCND1-UTR-Not1-3.4 CCND1-UTR-Not1-3.4 the miR-503 binding sites were deleted.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: