Sentence examples for binding sites we created from inspiring English sources
To verify the specificity of ER binding sites, we created a heat-map based on previously published ChIP-Seq data [ 21, 45].
To validate the functional consequences of small molecules binding at these sites we created 12 point mutations, either to alanine (smaller) or to tyrosine (larger) on the surface of the DH domain around the pockets.
To further minimize the possibility that merged targets might create larger binding sites, we reduced the radius of targets to 30 nm while maintaining the minimal distance between the centers of two targets at 80 nm.
More active mercury binding sites were created on brominated petroleum cokes after the chemical-mechanical bromination process.
Sequence logos of binding sites were created using the Weblogo server [ 47].
Based on these six instances, a multiple alignment of the six potential binding sites was created and visualised as a sequence logo (Fig. 5A; [ 30]).
Transcription factor binding sites putatively created by the SINE insertion Ins227bp were analysed by the software tools JASPAR (version 5.0_ALPHA) [ 28, 29], MatInspector (version 8.2) [ 30] and UniPROBE (state of March 2015; [ 31] calling upon different databases.
The pGL3 AR600 construct (containing the 5' UTR of AR, with several potential Sry binding sites) was created by PCR with R-ARNco (gtaccatggtttagcttgtctctagcttccacc) and LARSma600 (cacccgggtaactccctttggctga) and cloned in with Nco I and Sma I restriction digest and ligation.
Many Sir binding sites are created by the binding of Rap1 to the telomeric repeats and the anchoring of telomeres through both yKu and Sir4, leading to the sequestration of Sir proteins away from the rest of the genome [ 64, 76].
We show that all actin binding sites are not created equal and that there are two components to binding, cooperativity and affinity.
Importantly, this definition excludes potential binding sites that have not been demonstrated to bind ligands (so called unliganded binding sites), thereby creating a bias towards currently exemplified protein ligand complexes.
