Sentence examples for binding sites was created from inspiring English sources

Based on these six instances, a multiple alignment of the six potential binding sites was created and visualised as a sequence logo (Fig. 5A; [ 30]).

The pGL3 AR600 construct (containing the 5' UTR of AR, with several potential Sry binding sites) was created by PCR with R-ARNco (gtaccatggtttagcttgtctctagcttccacc) and LARSma600 (cacccgggtaactccctttggctga) and cloned in with Nco I and Sma I restriction digest and ligation.

More active mercury binding sites were created on brominated petroleum cokes after the chemical-mechanical bromination process.

Sequence logos of binding sites were created using the Weblogo server [ 47].

Many Sir binding sites are created by the binding of Rap1 to the telomeric repeats and the anchoring of telomeres through both yKu and Sir4, leading to the sequestration of Sir proteins away from the rest of the genome [ 64, 76].

Before docking, the extracellular and intracellular loops were removed and a binding site was created using 'define and edit binding site' protocol (Discovery Studio 3.5, Accelrys).

The X-ray structure of the previously known IL-2/inhibitor complex revealed an adaptive IL-2 interface, in which a small molecule binding site was created.

Furthermore, an avidin with two specific ligand-binding sites was created by applying the same modification to dcAvd.

The new R6G binding site is created due to the partial occlusion of the wt site by an alternate conformation adopted by the E90Q side chain, and is also accommodated by a second conformation of the E120 side chain (Figures 2D E).

Thus, an isoprostane binding site is created by the IP/TPα heterodimers (Wilson et al., 2004).

Based on a series of mutagenesis we predict that the collagen binding site is created by both the catalytic and the hemopexin domains.