Sentence examples for binding sites in addition from inspiring English sources
The proximal promoter region is just upstream of the transcription start site and contains a GC box that binds Sp1, NF-κB, and nuclear factor (NF -1 biNF -1 sites, in addition to two activator protein (AP)-1 sites.
Docking simulations suggested that these Y-shaped inhibitors might interact with multiple secondary binding sites in addition to the catalytic site of PTP1B.
RNase A has a series of base and phosphate binding sites, in addition to the catalytic site, that help in its binding to RNA.
More recently we showed that the amino-terminal catalytic Josephin domain also contains two distinct Ub binding sites in addition to the 2-3 UIMs contained in the C-terminus [17].
When searching for ER binding sites, in addition to predicted TFBSs as described above, information from TRANSFAC [41] and pattern search implementation using 3 consensus sequences, TCGACGCTTTCAAGGTCATATCCG, TCGACAAAGTCAGGTCACAGTGACCTGATCAAG and GGTCANNNTGACC, where 'N' represents an arbitrary nucleotide, [9], [42] were also utilized.
A specific feature of mammalian copper ATPases is an amino-terminal extension (NMBD) that includes six copper binding sites in addition to the TMBS (1).
The promoter region construct harbors an NF-κB, an Sp1, and an NF-1 binding site, in addition to two AP-1 sites, while the enhancer region construct harbors 2 NF-κB binding sites.
Biochemical and structural analysis illustrated pTyr-independent interaction between the N-terminal SH2 domain of PLCγ1 and the tyrosine kinase domain of the fibroblast growth factor receptor (FGFR) via a secondary binding site, in addition to the canonical pTyr-binding primary site [ 76].
ChAP-seq and transcriptome analyses in solid culture suggested 150 new 'apparently relevant' AdpA-binding sites in addition to the 304 sites described above.
The core 361-bp sequence contains putative RAREs and a TCF/LEF-binding site in addition to the Hox-binding sites previously identified (Minguillon et al., 2012; Nishimoto et al., 2014).
These authors suggested that the MID domains of certain eukaryotic AGOs (that is, those involved in miRNA-mediated gene regulation) contain a second nucleotide-binding site in addition to the 5′-phosphate-binding pocket, which gains affinity for mGpppG cap analogues (or eventually for other ligands) only in the presence of the guide-strand RNA (and vice versa).
