Sentence examples for binding sites created by from inspiring English sources

Exact(1)

While the PIP2 binding sites created by NaD1 oligomers has features seen in other PIP2 binding modules, NaD1 adopts a fold distinct from the other well-established protein domains.

Similar(58)

The MatInspector Tool v2.2 was used to search Genomatix Suite [ 38] for putative transcription factor binding sites created or abolished by the promoter polymorphisms.

In particular, our data identify a Zn II -binding site created by the side chains of E37, E42, and C66, the latter from the predicted C64XCC67 metal-binding motif.

Transcription factor binding sites putatively created by the SINE insertion Ins227bp were analysed by the software tools JASPAR (version 5.0_ALPHA) [ 28, 29], MatInspector (version 8.2) [ 30] and UniPROBE (state of March 2015; [ 31] calling upon different databases.

Furthermore, an avidin with two specific ligand-binding sites was created by applying the same modification to dcAvd.

The binding of a single activating protein to a binding site creates a complex that can in turn be recognized by RNA Polymerase (RNAP) molecules.

Many Sir binding sites are created by the binding of Rap1 to the telomeric repeats and the anchoring of telomeres through both yKu and Sir4, leading to the sequestration of Sir proteins away from the rest of the genome [ 64, 76].

The pGL3 AR600 construct (containing the 5' UTR of AR, with several potential Sry binding sites) was created by PCR with R-ARNco (gtaccatggtttagcttgtctctagcttccacc) and LARSma600 (cacccgggtaactccctttggctga) and cloned in with Nco I and Sma I restriction digest and ligation.

Methylation of the +37 CpG site, the CpG site created by the C allele at rs143383 or both sites has little or no effect on SP1 or SP3 binding on the background of the C allele at rs143383.

Thus, an isoprostane binding site is created by the IP/TPα heterodimers (Wilson et al., 2004).

Based on a series of mutagenesis we predict that the collagen binding site is created by both the catalytic and the hemopexin domains.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: