Sentence examples for binding site was removed from inspiring English sources

Exact(1)

The N-terminal domain between L5 and P125, located between 28 Å and 54 Å from the binding site, was removed to reduce the computational demand.

Similar(59)

The crystal water molecules that were considered as important by the DUD-E team, were conserved in the cavities, but cofactors that were not in the binding site were removed and only cofactors that were part of a cavity were included in the final structure.

Water molecules further than 5Å away from the binding site were removed, and finally the hydrogen bonding network was optimized.

A CMH test was employed to determine whether the frequency at which a binding site is removed in at least one isoform is significantly different from that obtained under this random model of AS.

deletion construct: a 64 bp GC-rich fragment located at positions -722 to -658 of the S100a6 promoter (5'CTAGCCTCAGGCGCCGGGTGGGGCTCGGGGCGGGCCGGCACTCCTTGGGCGGGCCTCCCGGATG-3'), containing two putative SP1 binding sites, was removed from construct dS16 by NheI digestion.

If the translocation from site to site implied relatively small activation energies (i.e. it was fast, Figure 5C) and if the total binding energy was sufficiently large, such a structure may be expected to move by biased diffusion along the microtubule when binding sites are removed from the edge of the binding surface on microtubule disassembly.

DOI: http://dx.doi.org/10.7554/eLife.05118.012 Next, we asked whether SNT-1-RBG-1 binding is still affected by Ca2+ treatment if the Ca2+-binding sites are removed from SNT-1.

pAZ20 is a modified version of pLM1000 [25] in which the amber stop codon between the λcI DNA-binding domain and the attL Gateway site was removed and a SfiI site was created between the Gateway sites via site-directed mutagenesis.

An N-glycosylation motif near the substrate binding site was disrupted to remove spatial hindrance for phytate entry and product departure.

This was also observed for those proteins in which the binding site is selectively removed in one or more isoforms.

However, some cases in which the binding site is selectively removed exist, and here we discuss one of them.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: