Sentence examples for binding site was amplified from inspiring English sources

A 378-bp fragment of the PDCD4 3′-UTR conthening the presumed miR-181b binding site was amplified by PCR with human genomic DNA as a template.

The 3' UTR of MYH9 containing let-7f binding site was amplified by PCR.

The human DUSP1 genomic region containing the predicted GR binding site was amplified by PCR using specific primers.

Plasmids used in this work were constructed as follows: pE2wt, pE71, pE81, and pE600: The relE2Spn gene with its own ribosome binding site was amplified by PCR from chromosomal DNAs of strains R6 (pE2wt), 7153 (pE71), 8151 (pE81), or K-600 (pE600) and amplified with primers relE2N (5'-CGCG GandCGATGCATGATTTAGGCTTGAAGGATGAATA-3') and relE2tga (5'-CGTGGTACCTCAATAAATATCTCTCCGATGACCAACTTC-3').

A putative β-catenin/TCF binding site was amplified by PCR.

The 3′UTR of the CCL4 gene containing a putative miR-125b binding site was amplified from human genomic DNA.

To construct 3'UTR reporter plasmids, two ∼400 bp fragments of the 3'UTR of human PTEN containing the putative miR-29a binding site were amplified from HepG2 cells cDNA, and cloned downstream of the luciferase reporter gene of a pGL3-control vector (Promega).

The 110-bp promoters with/without the Cbf1 binding site were amplified from four K. lactis Module 5 genes: KLLA0D05082g (KLLA0C00825gA0C00825g (KLLA0F13838gand13838g (KLLA0E23639g KLLA0E23639g (KLLA0E23639g

The 3′-UTR sequences of MCL-1 (GenBank accession number: NM_001197320) containing the putative miR-193b binding site were amplified by PCR using the cDNA from MCF-7/DOXR cells as a template.

The human TRAIL promoter region containing the Sp1 binding sites was precipitated using either the anti-Sp1 antibody or IgG, and using the probe 1 (forward) and the probe 5 (reverse) shown in Figure 5A as gene-specific primers and the sequence (136 bp) encompassing the Sp1 binding sites was amplified.

A 4-kb fragment of the 4.8-kb human TFGBR1 3'UTR (containing both putative let-7c binding sites) was amplified by PCR applied on genomic DNA extracted from HEK293 cells, using primers: 5'- CCAAGTTTAAACAGATCTGCTCCTGGGTTTTA (PmeI), and 5'- CCAAGCTAGC-ACCGGTATGCTCTGACAAATATTAAAC (NheI, AgeI), and cloned into the PmeI/NheI sites of pmirGLO, to generate pmirGLO-TGFBR1-long 3'UTR.