Your English writing platform
Discover LudwigSuggestions(5)
Exact(13)
A 378-bp fragment of the PDCD4 3′-UTR conthening the presumed miR-181b binding site was amplified by PCR with human genomic DNA as a template.
The 3' UTR of MYH9 containing let-7f binding site was amplified by PCR.
The human DUSP1 genomic region containing the predicted GR binding site was amplified by PCR using specific primers.
Plasmids used in this work were constructed as follows: pE2wt, pE71, pE81, and pE600: The relE2Spn gene with its own ribosome binding site was amplified by PCR from chromosomal DNAs of strains R6 (pE2wt), 7153 (pE71), 8151 (pE81), or K-600 (pE600) and amplified with primers relE2N (5'-CGCG GandCGATGCATGATTTAGGCTTGAAGGATGAATA-3') and relE2tga (5'-CGTGGTACCTCAATAAATATCTCTCCGATGACCAACTTC-3').
A putative β-catenin/TCF binding site was amplified by PCR.
The 3′UTR of the CCL4 gene containing a putative miR-125b binding site was amplified from human genomic DNA.
Similar(47)
To construct 3'UTR reporter plasmids, two ∼400 bp fragments of the 3'UTR of human PTEN containing the putative miR-29a binding site were amplified from HepG2 cells cDNA, and cloned downstream of the luciferase reporter gene of a pGL3-control vector (Promega).
The 110-bp promoters with/without the Cbf1 binding site were amplified from four K. lactis Module 5 genes: KLLA0D05082g (KLLA0C00825gA0C00825g (KLLA0F13838gand13838g (KLLA0E23639g KLLA0E23639g (KLLA0E23639g
The 3′-UTR sequences of MCL-1 (GenBank accession number: NM_001197320) containing the putative miR-193b binding site were amplified by PCR using the cDNA from MCF-7/DOXR cells as a template.
The human TRAIL promoter region containing the Sp1 binding sites was precipitated using either the anti-Sp1 antibody or IgG, and using the probe 1 (forward) and the probe 5 (reverse) shown in Figure 5A as gene-specific primers and the sequence (136 bp) encompassing the Sp1 binding sites was amplified.
A 4-kb fragment of the 4.8-kb human TFGBR1 3'UTR (containing both putative let-7c binding sites) was amplified by PCR applied on genomic DNA extracted from HEK293 cells, using primers: 5'- CCAAGTTTAAACAGATCTGCTCCTGGGTTTTA (PmeI), and 5'- CCAAGCTAGC-ACCGGTATGCTCTGACAAATATTAAAC (NheI, AgeI), and cloned into the PmeI/NheI sites of pmirGLO, to generate pmirGLO-TGFBR1-long 3'UTR.
More suggestions(18)
binding site was prepared
binding protein was amplified
binding site was based
binding site were amplified
binding site was named
binding site was defined
binding site was identified
binding site was conserved
binding site was predicted
binding site was analyzed
binding site was disrupted
binding site was used
binding site was shown
binding site was mutated
binding site was found
binding site was explored
binding site was positioned
binding site was confirmed
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com