Sentence examples for binding site is created from inspiring English sources

Exact(4)

The new R6G binding site is created due to the partial occlusion of the wt site by an alternate conformation adopted by the E90Q side chain, and is also accommodated by a second conformation of the E120 side chain (Figures 2D E).

Thus, an isoprostane binding site is created by the IP/TPα heterodimers (Wilson et al., 2004).

Based on a series of mutagenesis we predict that the collagen binding site is created by both the catalytic and the hemopexin domains.

This suggests that a high-affinity Na+ binding site is created transiently after photoexcitation, and entry of Na+ from the bulk to this site redirects the course of events in the remainder of the cycle.

Similar(56)

Before docking, the extracellular and intracellular loops were removed and a binding site was created using 'define and edit binding site' protocol (Discovery Studio 3.5, Accelrys).

The X-ray structure of the previously known IL-2/inhibitor complex revealed an adaptive IL-2 interface, in which a small molecule binding site was created.

More active mercury binding sites were created on brominated petroleum cokes after the chemical-mechanical bromination process.

Sequence logos of binding sites were created using the Weblogo server [ 47].

Based on these six instances, a multiple alignment of the six potential binding sites was created and visualised as a sequence logo (Fig. 5A; [ 30]).

The pGL3 AR600 construct (containing the 5' UTR of AR, with several potential Sry binding sites) was created by PCR with R-ARNco (gtaccatggtttagcttgtctctagcttccacc) and LARSma600 (cacccgggtaactccctttggctga) and cloned in with Nco I and Sma I restriction digest and ligation.

Many Sir binding sites are created by the binding of Rap1 to the telomeric repeats and the anchoring of telomeres through both yKu and Sir4, leading to the sequestration of Sir proteins away from the rest of the genome [ 64, 76].

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: