Sentence examples for binding site introduced in from inspiring English sources

Exact(1)

This probe recognizes an alternative binding site introduced in the target gene by overlap-extension PCR (11 ).

Similar(58)

This vector contained a second ribosomal-binding site introduced between the SalI and NotI sites by the primer GTCGACAATAATTTTGTTTAACTTTAAG AAGGAGATATA CATATG GCGGCCGC (SalI and NotI sites are in italics, the ribosomal-binding site is bold, and NdeI site is underlined).

In this work, the influence of GU base pairs on the effectivity of translation attenuation by miRNAs is assayed by mutating binding sites and comparing attenuation effectivity to wild type binding sites Introducing three GU base pairs into the mRNA/miRNA duplex did, with only minor changes to the binding energy, almost completely destroy the functionality of the binding site.

Mutations of potential trans-regulator binding sites were introduced in one of the truncated msn DNAs using the QuickChange site-directed mutagenesis kit from Stratagene.

To clarify the contribution of the other potential binding sites, mutations were introduced in order to disrupt the PTB consensus binding sequence in BS1, BS2 and BS3 in all possible combinations (Fig 4a).

Inhomogeneity in terms of binding sites was introduced to increase the temperature range in which H2 can be formed toward higher temperatures.

Finally, to verify that the CREB-like sites as well as the E2F-1 site within the AP-2α promoter were involved in the regulation of AP-2α transcription, we altered each binding site by introducing point mutations.

This adjustment was made to accommodate for proteins with more than one known binding site (CHEN11 dataset, also introduced in [31] contains on average more than 2 binding sites per protein, see Table 1).

PmeI and NheI restriction sites were introduced in the primer as cloning sites for NR ligand binding domains.

When a potential miR-222-binding site was introduced, as is the case in the ETV1long construct, miR-222 overexpression led to a small but significant decrease (12%, P=0.02) in the luciferase activity.

The mutations were detected using novel restriction sites (underlined) introduced in the seed region for miRNA binding.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: