This vector contained a second ribosomal-binding site introduced between the SalI and NotI sites by the primer GTCGACAATAATTTTGTTTAACTTTAAG AAGGAGATATA CATATG GCGGCCGC (SalI and NotI sites are in italics, the ribosomal-binding site is bold, and NdeI site is underlined).
In this work, the influence of GU base pairs on the effectivity of translation attenuation by miRNAs is assayed by mutating binding sites and comparing attenuation effectivity to wild type binding sites Introducing three GU base pairs into the mRNA/miRNA duplex did, with only minor changes to the binding energy, almost completely destroy the functionality of the binding site.
Mutations of potential trans-regulator binding sites were introduced in one of the truncated msn DNAs using the QuickChange site-directed mutagenesis kit from Stratagene.
To clarify the contribution of the other potential binding sites, mutations were introduced in order to disrupt the PTB consensus binding sequence in BS1, BS2 and BS3 in all possible combinations (Fig 4a).
Inhomogeneity in terms of binding sites was introduced to increase the temperature range in which H2 can be formed toward higher temperatures.
Finally, to verify that the CREB-like sites as well as the E2F-1 site within the AP-2α promoter were involved in the regulation of AP-2α transcription, we altered each binding site by introducing point mutations.
This adjustment was made to accommodate for proteins with more than one known binding site (CHEN11 dataset, also introduced in [31] contains on average more than 2 binding sites per protein, see Table 1).
PmeI and NheI restriction sites were introduced in the primer as cloning sites for NR ligand binding domains.
When a potential miR-222-binding site was introduced, as is the case in the ETV1long construct, miR-222 overexpression led to a small but significant decrease (12%, P=0.02) in the luciferase activity.
The mutations were detected using novel restriction sites (underlined) introduced in the seed region for miRNA binding.
