Sentence examples for binding region is present from inspiring English sources

The Myo Va cargo binding region is present in the tail region where it binds to melanosomes [27].

This indicates that the short primer-binding region was present at least twice on the same mtDNA molecule, which is a hallmark of duplications and multiplications (Fig.  5B).

In the DSP genomic locus, a p63-binding region was present in the first intron and corresponded to a genomic region enriched in positive histone marks associated with active transcription, and to a cluster of DNase hypersensitive sites (Supplementary Material, Fig. S2A) (59, 59).

The FlexX scores at different binding regions were presented in Table 5(b).

The consensus sequence (GCTCTGCTCGCCCACCACCCAATCCTCGCCTC) for binding of GLI1 onto the Cyclin D2 promoter region is present in the third CpG island.

This binding region is not similar to those previously identified as Rac binding motifs.

The NADPH binding region is yet unclear.

This could occur if the TRE1 region was present in some large fragments of DNA immunoprecipitated due to TR binding to the TRE2.

Curiously, the GlnRS (45754-mRNA) lacks N-terminal RNA binding region that is present in human and other fungal homologs.

In addition to the active site motif, two additional regions are present for binding of GSH; the residues preceding the cis-proline (consensus: TVP) and the residues following the GG-motif (consensus: GGxdD) (Lillig et al. 2008).

Some of the newly identified regulatory genes with NtcA binding regions were those encoding the transcriptional repressor SmtB (present in the beta plasmid), the two-component response regulator RpaA, or the Ser/Thr phosphatase Alr3732.