Sentence examples for binding coordinated from inspiring English sources

One explanation for this observation may be that the second-largest subunit's contribution to magnesium ion binding at the Metal B site is slightly less critical than the magnesium binding coordinated by the largest subunit.

Using functional enrichment analysis of Spalax hypoxia induced genes we found highly significant overrepresentation of groups of genes involved in anti apoptosis, cancer, embryonic/sexual development, epidermal growth factor receptor binding, coordinated suppression and activation of distinct groups of transcription factors and membrane receptors, in addition to angiogenic related processes.

To assess the positional accuracy of these estimates made by different programs, the distance was calculated between each predicted binding coordinate and the centers of high confidence binding motifs within 250 bp (Figure 7, Table S3).

Binding positions were estimated as the center of the reported peak region, if the program did not provide a predicted binding coordinate (HPeak, PeakSeq and Sole-Search; starred in Figure 7).

It was found that F327 and the dynamic part of the C-tail flanking this site play an essential role in regulating kinase activity by participating in ATP binding, coordinating the positioning of the Glycine-rich Loop for catalysis and by stabilizing the linker joining the two lobes of the kinase core.

The kinetic, structural, and energetic data together suggest that ortho substitution on the inhibitor B ring and the extra tail length on the A ring can stabilize the EI* state while the transition state on the binding coordinate is destabilized, resulting in an increased barrier for inhibitor dissociation.

Significantly, PT155, despite its structural similarity to PT70, does not exhibit slow-onset inhibition kinetics, suggesting that the open and closed conformations of helix-6 may distinguish the enzyme structure in the EI and EI* complexes on the PT70 binding coordinate.

Where relevant, binding coordinates were converted to Genome Release 5 (dm3) using the UCSC liftover tool.

Although the PESs were calculated with binding coordinates, in the dynamics calculations they were converted to the Jacobi scattering coordinates shown in Figure 1.

2464 ab initio points were calculated across the following binding coordinates: r NO: every 0.2 bohr from 1.75 to 2.95 bohr.

The PCR primers were: FF4: GTAATAAGAGATTTTACCACTG; and FR7: TCAATTTCTGTTTTATCTAATTCCG (primer binding coordinates for the type F1 neurotoxin gene of strain Langeland are 1792 1813 and 3209 3233, respectively).