Sentence examples for binding activity was verified from inspiring English sources

DNA binding activity was verified by EMSA using the sequence: 5′ GCCACGGCCCAGGAAGTGACTCACCCACCCTGATG as previously described [ 5].

Trypsin activity was verified using a synthetic substrate.

The absence of NaGlu activity was verified by enzyme assay in brain extracts.

CHIP E3 activity was verified in these assays by CHIP auto-ubiquitinylation (Fig. 3B).

Genotoxic activity was verified in PBMC by comet assay.

Gel viscosity and anti-HIV activity were verified for each Lot prior to in vivo use.

Your activities are verified with GPS, photos and other services.

To verify that the binding activity was due to the presence of Pax-5 we performed a super-shift experiment using a Pax-5 specific antibody, a control antibody or no antibody in the binding reaction.

NF-κB binding activity was also increased markedly.

Pleasingly, simultaneous binding activity was confirmed.

DNA binding activity was assessed by EMSA.