Sentence examples for bind to the variant from inspiring English sources

The adherent cells were co-transfected with 1 µg of luciferase reporter with variant K-Ras allele and a small interfering RNA (0.4 nM) designed to bind to the variant LCS6 K-Ras allele (ggacuggaguucacuacgugu). Qiagen AllStars Negative Control siRNA (0.4 nM) was used as negative control.

Let-7 is known to bind to the non-variant and not the variant LCS6 allele preventing KRAS protein synthesis.

However, it is also can be hypothesized that estrogen may bind to the -6A variant more effectively and AGT gene expression could be more in this variant.

PEP binding was not affected when up to 1 mM MgADP was added to the assays, suggesting that MgADP does not bind to the N59D/A158T/S215H variant of TtPFK at physiological concentrations.

The study used in vitro GEMSA (Gel Electrophoretic Mobility Shift Assay) with nuclear extract from Oct4-overexpressing cells to provide evidence that Oct4 did not bind to the sequence variant containing CpG (P) but only to the one having a TpG instead of CpG.

To further map the interaction site(s) on PKAc, we performed a peptide walk to determine specific amino acids required for PKAc to bind to the three AKIP1 splice variants.

To verify whether the MgADP is able to bind to the allosteric site of this variant, the PEP binding was measured as a function of MgADP concentration.

GC-MS analysis as performed for wild-type cADO indicated host-derived fatty acid ligands were not bound to the purified variant proteins.

Both programmes used also suggested that transcription factors would bind to the DNA sequences and that the variants would destroy binding.

Similar to the KDM5B-N variant, the KDM5B-PC, KDM5B-N-△C and KDM5B-N-△ZF variants bind to the unmodified H3K4 peptide, implying that the JmjC domain, the Zf-C5HC2 domain, and the JmjN-ARID domain are not involved in the interaction with the unmodified H3K4 peptide.

The calculated K d values showed that the four selected "cavity" single amino acid mutation variants bind to the IFN γSC with similar affinity as WT; a modest increase was observed for the V35L variant.