GFP intensity for each root was calculated by subtracting the average grayscale means of roots induced with A. rhizogenes containing no binary vector from the grayscale means of the transgenic GFP-expressing hairy roots using the green channel.
As shown in Table 2 for both CGIs and non-CGIs, the fractions of CTA and CTX genes residing within runs were significantly higher than their control groups (binary vectors from run-of-ones analysis permuted 100 times).
For the prediction set, we want to predict a pharmacological profile y (K-dimensional binary vector) from a chemical structure x (chemical graph).
Subsequently, Zhou et al.[ 30] produced an intermediate-sized double T-DNA binary vector from two popular binary vectors (pBin19 and pCAMBIA2300) for co-transformation to produce SMG-free transgenic tobacco.
As a technical way to improve public acceptance, we modified the "marker-free vector" of the Cre/loxP DNA excision system [74] to construct a high-capacity binary vector for the transformation of rice, from which the sequence sandwiched between two loxP sites (including the selectable marker) can be removed by 17β-estradiol administration [68].
The scheme for the construction of TuMV full-length clones in the binary vector pBD003 from the p35S-TuMV series is shown in Figure 2B.
The development of the hairy root phenotype caused by A. rhizogenes is the result of the integration and expression of T-DNA contained in the bacterial root inducing (Ri) plasmid in the plant genome [ 54]. A. rhizogenes can also transfer the T-DNA from binary vectors, leading to the formation of hairy roots with or without the binary vector T-DNA.
Indeed, as shown in Figure 3, a comparison of pABr1- and pABr3-transformed hyphae (obtained after 3 days of co-cultivation with the AGL-1/pABr1 and AGL-1/pABr3 Agrobacterium strains) revealed an approximately 6-fold higher transformation efficiency with the latter binary vector, likely resulting from the combined effect of a smaller sized T-DNA and an enhanced expression of the SGFP reporter.
The translational fusion construct Zera-Xyl was inserted into the binary vector pC2300 containing the enhanced 35S promoter, the tobacco etch virus (TEV) translation enhancer and the 3' polyadenylation sequences from the cauliflower mosaic virus (CaMV) yielding vector pCZera-Xyl.
Next, the kanamycin resistance gene (KanR) was amplified from pBI121 binary vector with the primer pair FP-8-6-SacII (5′- GCCTGTGATCATCCGCGG TTTCAAAATCGGCTCCG -3′) and RP-AvrII (5′- GGTTTTTTTGTTTGCAAGCCTAGG CAGATTACGCGC -3′), which contains Sac II and Avr II (underlined), respectively.
