Sentence examples for between these data tags from inspiring English sources

For the 993 loci in common between these data, tags matched specific alternative canonical sites in 402 instances among the full length cDNA/EST data.

It is necessary to estimate a time-tag bias for the KBRR data to accommodate any residual time offsets between these data and the time tags of the DSN data [ Kruizinga et al., 2013].

These discriminative results with Deep Learning are useful for data tagging and information retrieval and can be used in search engines.

The php code goes in between these two tags.

Everything in between these head tags won't actually be displayed on the page itself.

For the rest of this tutorial, everything your write will go in between these body tags.

Remember to write everything else in this tutorial in between these two tags.

Among these tag profiling data one tag with the sequence CATGACAAGTTTTTGTTAATAATAAT, corresponding to the ribulose-bisphosphate carboxylase activase gene (Os11g0707000 was represented by less counts in sample d (3,291 tags) as compared to the two other replicates (11,544 and 9,234 tags).

These data illustrate that the dibromide tag imparts a more distinctive signature on a peptide's mass envelope than the other halogen tags.

In this paper, we decouple the traditional one-to-one mapping between data and tag arrays for cache structures.

For example a fully methylated tag is "111111111" and an unmethylated tag is "000000000", and the distance between these tags is nine.