Sentence examples for between the termination codon from inspiring English sources
The distance between the termination codon of the third HIC uORF and the initiation codon of the HIC ORF is less than 40 nt.
(CTG 400 tracts were cloned into an SfiI site located within a linker sequence (TGGCCACGCGGGCCATTTAAATGGCCATTAGGGCC: SfiI sites are underlined) that was inserted between the termination codon of the β-galactosidase gene and the bovine growth hormone polyadenylation (BGH-PolyA) sequence.
An 8-nt overlap occurred between the termination codon of ORF1b and the initiation codon of ORF2.
The conservation pattern is very similar between S. barkhanus and S. salmonicida, with a strong positional correlation between the termination codon and the beginning of the polyA-tail, but only weak conservation outside the UGA codon, the only functional termination codon in Spironucleus [ 17].
The 3' untranslated regions (UTR) of S. salmonicida genes appear to be short; the average distance between the termination codon and the first A in the polyA tail is 13.2 bases and in 122 of the 134 cases the distance is between 9 and 14 nucleotides.
The positional correlation between the termination codon and the polyA site in S. barkhanus and S. salmonicida [ 14] suggests that the single termination codon [ 17] likely also function as a polyA signal, in addition to the function as a Sec-codon in selenoproteins.
We did not find an association between the ERV3 allele with the termination codon and this disease.
We also designed PCR primers to detect the correctly spliced transgenic Ugp1 transcripts by amplifying the sequence between the exon of the Ubi1 promoter and the termination codon of Ugp1.
Mutation of the termination codon resulted in production of a C-terminal elongated protein.
To achieve a high-level co-expression of reporter mCherry with the target gene, an optimized strong RBS and spacing between SD sequence and ATG initiator codon (Pfleger et al. 2006) were placed immediately after the termination codon of the first ORF.
The resulting exoinzed transcripts were divided into 5 types by location of the termination codon (PTC) (Figure 1).
