Sentence examples for between the termination from inspiring English sources

An overview of these processes is presented with emphasis on the outer heliosphere where a considerable amount of modulation may take place, especially in the region between the termination shock and the modulation boundary/heliopause.

We propose a 3-D model to illustrate the contrasting Paleoproterozoic tectonic evolution between the northern and southern domains of the Lüliang Complex and the TNCO during the transition stage between the termination of oceanic subduction and the subsequent continental collision.

Saccade amplitude was calculated as the difference between the final and initial eye positions, and saccade duration as the difference between the termination and onset times.

The distance between the termination codon of the third HIC uORF and the initiation codon of the HIC ORF is less than 40 nt.

(CTG 400 tracts were cloned into an SfiI site located within a linker sequence (TGGCCACGCGGGCCATTTAAATGGCCATTAGGGCC: SfiI sites are underlined) that was inserted between the termination codon of the β-galactosidase gene and the bovine growth hormone polyadenylation (BGH-PolyA) sequence.

However, it is unlikely that higher levels of hASM would have been detected in CNS tissue if the interval between the termination of the infusion procedure and tissue collection had been increased.

The open space design of the humanist typefaces supports distinctive and highly visible forms; the distance between the terminations works to avoid the meshing together of forms and keeps these features easily identifiable (Bouma 1970, 1973; Pelli et al. 2009).

Emails that have emerged in the last few weeks indicate that the DWSD attempted on multiple occasions to broker a deal with Flint in the months between sending the termination letter and the water switch.

Synovial fluid is collected at the time of surgery and at nine additional evenly spaced time periods between surgery and the termination of the study at 70 days.

For the chromosome, the origin site is assumed to lie between genes LI0775 and LI0776, whereas the termination between genes LI0227 and LI0228.

At this latitude, the amount of proton modulation between the heliopause and the termination shock is much reduced.