Sentence examples for between the stop codon from inspiring English sources
The IRES-Puro-pA fragment and the F5 flanked selection cassette were inserted between the stop codon and the polyA signal sequence of SFTPC gene.
In the long DNA donor template, an IRES-Puro-pA expression cassette was inserted between the stop codon and the polyA signal sequence of SFTPC gene with two homologous arms around 1 kb.
The distance between the stop codon of the upstream gene and the start codon of the downstream gene was demonstrated to be of key importance in translational coupling (Levin-Karp et al. 2013).
Among mRNAs transcribed from such loci, only those that carry the miRNA recognized sequence between the stop codon and the polyA tail would be affected by miRNA regulation.
The 707 bp gap between the stop codon and the downstream contig was closed by sequencing directly off the fosmid clone using primers designed from the C-terminal coding region of MaSp2 and for the beginning of the downstream contig (all primer sequences used in this study are available upon request).
An alternative explanation is that the distance between the stop codon and the poly-A binding protein (PABP) is what triggers NMD, such that increasing the distance between the stop codon and the PABP increases the chance of NMD activation.
A FRT site was inserted between the stop codons and the transcription terminator of the srgE gene using λ Red recombination with PCR primers BA723 (TTGTATGGGGCATATAAAAAGAAATAGTAACATATGAATATCCTCCTTAG) and BA908 (TCAAATGCCAGACTTCCGCTACCAGACGGTGTGTAGGCTGGAGCTGCTTC).
The only difference between the stop codons in the two mitogenomes is for nad2 which uses the complete stop codon TAA in T. yunnanensis and the incomplete stop codon T in T. renzhiensis.
NMD has been shown to work well with a distance of at least 500 bp between the stop codons, and this region of let-858 had previously been shown to confer NMD when inserted downstream of other stop codons.
