Sentence examples for between the relative expression from inspiring English sources
The differences between the relative expression of fadD, fadL and fadE also raise some interesting observations.
OBJECTIVES: The Gynecologic Oncology Group GOGG) examined the association between the relative expression of the DeltaNp63alpha isoform and clinicopathologic variables, p53 status, angiogenic markers, progression-free survival (PFS) and overall survival (OS) in epithelial ovarian cancer (EOC).
Rice ubiquitin (GenBank accession number NM_001049450; Forward primer- GCGTAGGCTCCTGTTCTTTGG; Reverse primer- AGGGCATCACAATCTTCACAGA) was used as a reference gene for normalization and the fold change values were calculated between the relative expression values (REVs) of infested (RP-I) and un-infested (RP-UI) tissues.
Furthermore, when the expression levels of the up-regulated miRNAs were organized according to their cell line-determined expression patterns, a correlation emerged between the relative expression (compared with levels in pAGMK cells) of representative miRNAs and the evolution of the 10-87 VERO cells into cells that could form tumors in nude mice (Fig. 5).
Further, the presence of rye nucleolar chromosomes did not affect the intrinsic mechanisms associated with the differential expression of the wheat NORs from its B ancestral parental genome, since there is no significant difference between the relative expression patterns between 1B and 6B NORs in wheat and in wheat+1R1R.
Correlation between the relative expression level detected by qRT-PCR and by deep-sequencing was calculated.
Although differences in the absolute expression levels did not perfectly correlate between methodologies, the relative expression patterns did agree as has also been described by Linsen et al. [ 7].
Given that these ΔΔCT values are the log2 fold changes between two measurements, the relative expression levels between any sample and the mean of the major homozygotes is given by 2−ΔΔCT = 2̂(− ΔCT_Any Sample−mean ΔCT_Major Homozygotes))).
In contrast, there were no significant correlations between the relative expressions of MHC-β and either CS or HAD enzymatic activities in both ventricles after adjusting for the relative wet mass.
Of the genes examined, a significant correlation was only apparent between the relative expressions of Men and Abd-B (R = 0.318, P = 0.015; Figure 6A, Figure S1, Figure S2, and Figure S3).
